filtered p1000 pipet tips (Fisher Scientific)
86
Structured Review
Fisher Scientific
filtered p1000 pipet tips
Filtered P1000 Pipet Tips, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tip/10006m+elite+fa10001m+fisherbrand+multichannel+p1000l+pipettes+sku/pmc13188093-22-0-5
Average 86 stars, based on 1 article reviews
Filtered P1000 Pipet Tips, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tip/10006m+elite+fa10001m+fisherbrand+multichannel+p1000l+pipettes+sku/pmc13188093-22-0-5
Average 86 stars, based on 1 article reviews
filtered p1000 pipet tips - by Bioz Stars,
2026-10
86/100 stars
Images
Related Articles
Sonication:Article Title: First X-ray crystal structure of an insect muscle myosin / Article Snippet: .. Sonicated the solution in the 26.3 ml tubes on ice with 20 quick pulses at 50% duty cycle, setting of 5, with a micro Article Title: Near-Infrared Imaging of Serotonin Release from Cells with Fluorescent Nanosensors. Article Snippet: Synthesis of aptamer functionalized SWCNTs (NIRSers) (6,5) enriched SWCNTs (41% (6,5) chirality, carbon ≤95%, ≥93% carbon as SWCNT, Signis® SG65i, 0.7–0.9 nm diameter (Sigma-Aldrich, Germany) and the serotonin aptamer (a 57–mer sequence of 5’- CTCTCGGGACGACTGGTAGGCAGATAGGGGAAGCTGATTCGATGCGTGGGTCGTCCC -3’ 1 synthesized by Sigma-Aldrich, Germany) were mixed in MilliQ water to reach the final concentration of 0.5 mg/mL and 50 μM respectively. .. The dispersion was Article Title: Regulation of chromatin dynamics by a calcium-dependent nucleoskeleton. Article Snippet: .. Chromatin was sheared using a FB120 sonicator with CL-18 other:Article Title: Ammonia Emissions, Exposed Surface Area, and Crop and Weed Responses Resulting from Three Post-Emergence Slurry Application Strategies in Cereals Article Snippet: Following application, the slurry surface pH was measured with a flat-tip pH electrode (OrionTM 8135BN ROSSTM, Combination Dispersion:Article Title: Near-Infrared Imaging of Serotonin Release from Cells with Fluorescent Nanosensors. Article Snippet: Synthesis of aptamer functionalized SWCNTs (NIRSers) (6,5) enriched SWCNTs (41% (6,5) chirality, carbon ≤95%, ≥93% carbon as SWCNT, Signis® SG65i, 0.7–0.9 nm diameter (Sigma-Aldrich, Germany) and the serotonin aptamer (a 57–mer sequence of 5’- CTCTCGGGACGACTGGTAGGCAGATAGGGGAAGCTGATTCGATGCGTGGGTCGTCCC -3’ 1 synthesized by Sigma-Aldrich, Germany) were mixed in MilliQ water to reach the final concentration of 0.5 mg/mL and 50 μM respectively. .. The dispersion was Injection:Article Title: cAMP Response Element-Binding Protein Is Essential for the Upregulation of Brain-Derived Neurotrophic Factor Transcription, But Not the Behavioral or Endocrine Responses to Antidepressant Drugs Article Snippet: .. Thirty minutes after injection mice were individually suspended by the tail to a horizontal ring-stand bar (distance from floor, 35 cm) using Fisher Scientific (Pittsburgh, PA) adhesive tape affixed 2 cm from the Adhesive:Article Title: cAMP Response Element-Binding Protein Is Essential for the Upregulation of Brain-Derived Neurotrophic Factor Transcription, But Not the Behavioral or Endocrine Responses to Antidepressant Drugs Article Snippet: .. Thirty minutes after injection mice were individually suspended by the tail to a horizontal ring-stand bar (distance from floor, 35 cm) using Fisher Scientific (Pittsburgh, PA) adhesive tape affixed 2 cm from the |
